../../tmp/servers/virsirnadb/184875550
Result for your query siRNA sequence
| RED | =100 % Complementary sequence |
| . | =Identical residue |
| blue alphabets | =mismatch |
| _ | =Gap |
| Acc number | Strain name | Start | Alignment | End | % Identity |
| Query | virsi2005 | 1 | tgaggaactactgtcttcac | 20 | |
| X61596.1 | Hepatitis C virus core, E1, NS1/E2, NS2, NS3, NS4a, NS4b and NS5 gene | 31 | .................... | 50 | 100 |
| D10749.1 | HPCHCJ1 Hepatitis C virus genomic RNA, complete genome, isolate: HC-J1 | 48 | .................... | 67 | 100 |
| D13558.1 | HPCJ483 Hepatitis C virus genome, complete sequence | 48 | .................... | 67 | 100 |
| D10750.1 | HPCJ491 Hepatitis C virus genome, complete sequence | 48 | .................... | 67 | 100 |
| D10988.1 | HPCJ8G Hepatitis C virus genome | 48 | .................... | 67 | 100 |
| D90208.1 | HPCJCG Hepatitis C virus ORF gene, complete cds | 36 | .................... | 55 | 100 |
| D11168.1 | HPCJTA Hepatitis C virus (HCV) complete genome | 48 | .................... | 67 | 100 |
| D11355.1 | HPCJTB Hepatitis C virus genomic RNA, complete genome, strain: JT' | 48 | .................... | 67 | 100 |
| D00944.1 | HPCPOLP Hepatitis C virus genomic RNA for polyprotein, complete cds | 47 | .................... | 66 | 100 |
| M96362.1 | HPCUNKCDS Hepatitis C virus mRNA, complete cds | 49 | .................... | 68 | 100 |
| M67463.1 | HPCCGAA Hepatitis C virus subtype 1a, complete genome | 48 | .................... | 67 | 100 |
| L02836.1 | HPCCGENOM Hepatitis C virus subtype 1b strain HeBei, complete genome | 37 | .................... | 56 | 100 |
| M84754.1 | HPCGENANTI Hepatitis C virus subtype 1b strain Taiwan, complete genome | 48 | .................... | 67 | 100 |
| M58335.1 | HPCHUMR Hepatitis C virus subtype 1b, complete genome | 39 | .................... | 58 | 100 |
| M62321.1 | HPCPLYPRE Hepatitis C virus subtype 1a, complete genome | 48 | .................... | 67 | 100 |
| S62220.1 | Hepatitis C virus subtype 1b, complete genome | 47 | .................... | 66 | 100 |
| D14853.1 | HPCCGS Hepatitis C virus (isolate HC-G9) genomic RNA, complete genome | 48 | .................... | 67 | 100 |
| D10934.1 | HPCRNA Hepatitis C virus RNA, complete genome sequence | 48 | .................... | 67 | 100 |
| D30613.1 | HPCPP Hepatitis C virus complete genome sequence | 48 | .................... | 67 | 100 |
| U16362.1 | HCU16362 Hepatitis C virus subtype 1b, complete genome | 49 | .................... | 68 | 100 |
| X76918.1 | Hepatitis C virus genes for core, envelope and NS1 proteins | 5 | .................... | 24 | 100 |
| D50482.1 | HPCK1R3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R3), complete g | 36 | .................... | 55 | 100 |
| D50483.1 | HPCK1S1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S1), complete g | 36 | .................... | 55 | 100 |
| D50484.1 | HPCK1S3 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S3), complete g | 36 | .................... | 55 | 100 |
| D50485.1 | HPCK1S2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-S2), complete g | 36 | .................... | 55 | 100 |
| D50481.1 | HPCK1R2 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R2), complete g | 36 | .................... | 55 | 100 |
| D50480.1 | HPCK1R1 Hepatitis C virus (strain HCV-1b, clone HCV-K1-R1), complete g | 36 | .................... | 55 | 100 |
| D14484.1 | HPCJRNA Hepatitis C virus strain J33 genomic RNA, complete genome | 48 | .................... | 67 | 100 |
| U45476.1 | HCU45476 Hepatitis C virus isolate HD-1, complete genome | 48 | .................... | 67 | 100 |
| D63822.1 | HPCJK046E2 Hepatitis C virus (isolate JK046) genomic RNA, complete gen | 45 | .................... | 64 | 100 |
| D45172.1 | HPCHCPO Hepatitis C virus genomic RNA for HCV polyprotein, complete cd | 48 | .................... | 67 | 100 |
| D50409.1 | Hepatitis C virus (isolate BEBE1) genomic RNA, complete genome | 47 | .................... | 66 | 100 |
| D85516.1 | Hepatitis C virus genomic RNA, complete cds | 48 | .................... | 67 | 100 |
| AF011751.1 | Hepatitis C virus strain H77 pCV-H77C polyprotein gene, complete cds | 48 | .................... | 67 | 100 |
| AF011752.1 | Hepatitis C virus strain H77 pCV-H11 polyprotein gene, complete cds | 48 | .................... | 67 | 100 |
| U89019.1 | HCU89019 Hepatitis C virus subtype 1b, complete genome | 48 | .................... | 67 | 100 |
| AJ000009.1 | Hepatitis C virus complete genome sequence | 31 | .................... | 50 | 100 |
| D89815.1 | Hepatitis C virus genomic RNA, complete sequence | 48 | .................... | 67 | 100 |
| AF054247.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L6S, complete | 48 | .................... | 67 | 100 |
| AF054248.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L2S, complete | 48 | .................... | 67 | 100 |
| AF054249.1 | Hepatitis C virus subtype 1b strain HC-J4 isolate pCV-J4L4S, complete | 48 | .................... | 67 | 100 |
| AF054250.1 | Hepatitis C virus subtype 1b strain HC-J4, complete genome | 38 | .................... | 57 | 100 |
| AJ132996.1 | Hepatitis C virus, complete genome, isolate HCV-AD78 | 47 | .................... | 66 | 100 |
| AJ132997.1 | Hepatitis C virus, complete genome, isolate HCV-AD78P1 | 47 | .................... | 66 | 100 |
| AJ238799.1 | Hepatitis C virus type 1b complete genome, isolate Con1 | 48 | .................... | 67 | 100 |
| AF176573.1 | Hepatitis C virus subtype 1b strain 274933RU, complete genome | 48 | .................... | 67 | 100 |
| AB016785.1 | Hepatitis C virus genomic RNA, complete sequence | 48 | .................... | 67 | 100 |
| AF165045.1 | Hepatitis C virus subtype 1b strain MD1-1, complete genome | 36 | .................... | 55 | 100 |
| AF165046.1 | Hepatitis C virus subtype 1b strain MD1-2, complete genome | 36 | .................... | 55 | 100 |
| AF165049.1 | Hepatitis C virus subtype 1b strain MD3-1, complete genome | 36 | .................... | 55 | 100 |
| AF165051.1 | Hepatitis C virus subtype 1b strain MD4-1, complete genome | 36 | .................... | 55 | 100 |
| AF165052.1 | Hepatitis C virus subtype 1b strain MD4-2, complete genome | 36 | .................... | 55 | 100 |
| AF165053.1 | Hepatitis C virus subtype 1b strain MD5-1, complete genome | 36 | .................... | 55 | 100 |
| AF165054.1 | Hepatitis C virus subtype 1b strain MD5-2, complete genome | 36 | .................... | 55 | 100 |
| AF165055.1 | Hepatitis C virus subtype 1b strain MD6-1, complete genome | 36 | .................... | 55 | 100 |
| AF165056.1 | Hepatitis C virus subtype 1b strain MD6-2, complete genome | 36 | .................... | 55 | 100 |
| AF165057.1 | Hepatitis C virus subtype 1b strain MD7-1, complete genome | 36 | .................... | 55 | 100 |
| AF165058.1 | Hepatitis C virus subtype 1b strain MD7-2, complete genome | 36 | .................... | 55 | 100 |
| AF165059.1 | Hepatitis C virus subtype 1b strain MD8-1, complete genome | 36 | .................... | 55 | 100 |
| AF165060.1 | Hepatitis C virus subtype 1b strain MD8-2, complete genome | 36 | .................... | 55 | 100 |
| AF165061.1 | Hepatitis C virus subtype 1b strain MD9-1, complete genome | 36 | .................... | 55 | 100 |
| AF165062.1 | Hepatitis C virus subtype 1b strain MD9-2, complete genome | 36 | .................... | 55 | 100 |
| AF165063.1 | Hepatitis C virus subtype 1b strain MD10-1, complete genome | 36 | .................... | 55 | 100 |
| AF165064.1 | Hepatitis C virus subtype 1b strain MD10-2, complete genome | 36 | .................... | 55 | 100 |
| AB031663.1 | Hepatitis C virus (isolate VAT96) genomic RNA, complete genome | 48 | .................... | 67 | 100 |
| AF169002.1 | Hepatitis C virus subtype 2a isolate NDM228, complete genome | 47 | .................... | 66 | 100 |
| AF169003.1 | Hepatitis C virus subtype 2a isolate G2aK1, complete genome | 47 | .................... | 66 | 100 |
| AF169004.1 | Hepatitis C virus subtype 2a isolate G2aK3, complete genome | 47 | .................... | 66 | 100 |
| AF169005.1 | Hepatitis C virus subtype 2a isolate NDM59, complete genome | 47 | .................... | 66 | 100 |
| AF238481.1 | Hepatitis C virus subtype 2a strain MD2a-1, complete genome | 13 | .................... | 32 | 100 |
| AF238482.1 | Hepatitis C virus subtype 2a strain MD2a-2, complete genome | 13 | .................... | 32 | 100 |
| AF238483.1 | Hepatitis C virus subtype 2a strain MD2a-4, complete genome | 13 | .................... | 32 | 100 |
| AF238484.1 | Hepatitis C virus subtype 2a strain MD2a-5, complete genome | 13 | .................... | 32 | 100 |
| AF238485.1 | Hepatitis C virus subtype 2a strain MD2a-7, complete genome | 13 | .................... | 32 | 100 |
| AF238486.1 | Hepatitis C virus subtype 2b strain MD2b-1, complete genome | 11 | .................... | 30 | 100 |
| AF208024.1 | Hepatitis C virus subtype 1b strain MD34, complete genome | 36 | .................... | 55 | 100 |
| AF207752.1 | Hepatitis C virus subtype 1b strain MD11, complete genome | 36 | .................... | 55 | 100 |
| AF207753.1 | Hepatitis C virus subtype 1b strain MD12, complete genome | 36 | .................... | 55 | 100 |
| AF207755.1 | Hepatitis C virus subtype 1b strain MD14, complete genome | 36 | .................... | 55 | 100 |
| AF207756.1 | Hepatitis C virus subtype 1b strain MD15, complete genome | 36 | .................... | 55 | 100 |
| AF207757.1 | Hepatitis C virus subtype 1b strain MD16, complete genome | 36 | .................... | 55 | 100 |
| AF207758.1 | Hepatitis C virus subtype 1b strain MD17, complete genome | 36 | .................... | 55 | 100 |
| AF207760.1 | Hepatitis C virus subtype 1b strain MD19, complete genome | 36 | .................... | 55 | 100 |
| AF207761.1 | Hepatitis C virus subtype 1b strain MD20, complete genome | 36 | .................... | 55 | 100 |
| AF207762.1 | Hepatitis C virus subtype 1b strain MD21, complete genome | 36 | .................... | 55 | 100 |
| AF207763.1 | Hepatitis C virus subtype 1b strain MD22, complete genome | 36 | .................... | 55 | 100 |
| AF207764.1 | Hepatitis C virus subtype 1b strain MD23, complete genome | 36 | .................... | 55 | 100 |
| AF207765.1 | Hepatitis C virus subtype 1b strain MD24, complete genome | 36 | .................... | 55 | 100 |
| AF207766.1 | Hepatitis C virus subtype 1b strain MD25, complete genome | 36 | .................... | 55 | 100 |
| AF207767.1 | Hepatitis C virus subtype 1b strain MD26, complete genome | 36 | .................... | 55 | 100 |
| AF207768.1 | Hepatitis C virus subtype 1b strain MD27, complete genome | 36 | .................... | 55 | 100 |
| AF207769.1 | Hepatitis C virus subtype 1b strain MD28, complete genome | 36 | .................... | 55 | 100 |
| AF207770.1 | Hepatitis C virus subtype 1b strain MD29, complete genome | 36 | .................... | 55 | 100 |
| AF207771.1 | Hepatitis C virus subtype 1b strain MD30, complete genome | 36 | .................... | 55 | 100 |
| AF207773.1 | Hepatitis C virus subtype 1b strain MD32, complete genome | 36 | .................... | 55 | 100 |
| AF207774.1 | Hepatitis C virus subtype 1b strain MD33, complete genome | 36 | .................... | 55 | 100 |
| AF271632.1 | Hepatitis C virus subtype 1a clone pHCV-1/SF9 A, complete genome | 48 | .................... | 67 | 100 |
| AB030907.1 | Hepatitis C virus (isolate JPUT971017) genomic RNA, complete genome | 48 | .................... | 67 | 100 |
| AJ278830.1 | Hepatitis C virus genomic RNA for polyprotein gene | 48 | .................... | 67 | 100 |
| AF290978.1 | Hepatitis C virus subtype 1a isolate colonel, complete genome | 36 | .................... | 55 | 100 |
| AB049087.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT05 | 17 | .................... | 36 | 100 |
| AB049088.1 | Hepatitis C virus genomic RNA, complete genome, isolate: HCVT094 | 48 | .................... | 67 | 100 |
| AB049089.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT10 | 17 | .................... | 36 | 100 |
| AB049090.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 17 | .................... | 36 | 100 |
| AB049092.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT14 | 17 | .................... | 36 | 100 |
| AB049093.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT15 | 17 | .................... | 36 | 100 |
| AB049094.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 49 | .................... | 68 | 100 |
| AB049095.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT16 | 17 | .................... | 36 | 100 |
| AB049096.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 17 | .................... | 36 | 100 |
| AB049097.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT19 | 17 | .................... | 36 | 100 |
| AB049098.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT20 | 17 | .................... | 36 | 100 |
| AB049099.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 48 | .................... | 67 | 100 |
| AB049100.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT21 | 17 | .................... | 36 | 100 |
| AB049101.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: HCVT22 | 17 | .................... | 36 | 100 |
| AF333324.1 | Hepatitis C virus type 1b polyprotein mRNA, complete cds | 48 | .................... | 67 | 100 |
| AB047639.1 | Hepatitis C virus (isolate JFH-1) genomic RNA, complete genome | 47 | .................... | 66 | 100 |
| AB047640.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-1 | 47 | .................... | 66 | 100 |
| AB047641.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-2 | 47 | .................... | 66 | 100 |
| AB047642.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 | 47 | .................... | 66 | 100 |
| AB047642.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-3 | 877 | ___..c...........___ | 890 | 65 |
| AB047643.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-4 | 47 | .................... | 66 | 100 |
| AB047644.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-5 | 47 | .................... | 66 | 100 |
| AY051292.1 | Hepatitis C virus (isolate India) polyprotein mRNA, complete cds | 48 | .................... | 67 | 100 |
| AF356827.1 | Hepatitis C virus subtype 1b isolate HCV-S1, complete genome | 48 | .................... | 67 | 100 |
| AF356827.1 | Hepatitis C virus subtype 1b isolate HCV-S1, complete genome | 4310 | _____............___ | 4321 | 60 |
| AY045702.1 | Hepatitis C virus isolate HCR6, complete genome | 50 | .................... | 69 | 100 |
| AF483269.1 | Hepatitis C virus type 1b isolate HCV-TR1 from Turkey, complete genom | 13 | .................... | 32 | 100 |
| AF511948.1 | Hepatitis C virus isolate XF222 polyprotein-like gene, complete seque | 48 | .................... | 67 | 100 |
| AF511949.1 | Hepatitis C virus isolate XF223 polyprotein-like gene, complete seque | 48 | .................... | 67 | 100 |
| AF511950.1 | Hepatitis C virus isolate XF224 polyprotein-like gene, complete seque | 20 | .................... | 39 | 100 |
| AF139594.2 | Hepatitis C virus subtype 1b strain HCV-N, complete genome | 48 | .................... | 67 | 100 |
| AB080299.1 | Hepatitis C virus genomic RNA, complete genome, isolate:M1LE | 48 | .................... | 67 | 100 |
| AY232730.1 | Hepatitis C virus clone MD2b1-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232731.1 | Hepatitis C virus clone MD2b1-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232732.1 | Hepatitis C virus clone MD2b2-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232733.1 | Hepatitis C virus clone MD2b2-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232734.1 | Hepatitis C virus clone MD2b3-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232735.1 | Hepatitis C virus clone MD2b3-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232736.1 | Hepatitis C virus clone MD2b4-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232737.1 | Hepatitis C virus clone MD2b4-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232738.1 | Hepatitis C virus clone MD2b5-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232739.1 | Hepatitis C virus clone MD2b5-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232740.1 | Hepatitis C virus clone MD2b6-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232741.1 | Hepatitis C virus clone MD2b6-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232742.1 | Hepatitis C virus clone MD2b7-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232743.1 | Hepatitis C virus clone MD2b7-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232744.1 | Hepatitis C virus clone MD2b8-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232745.1 | Hepatitis C virus clone MD2b8-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232746.1 | Hepatitis C virus clone MD2b9-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232747.1 | Hepatitis C virus clone MD2b9-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232748.1 | Hepatitis C virus clone MD2b10-1 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY232749.1 | Hepatitis C virus clone MD2b10-2 polyprotein mRNA, complete cds | 11 | .................... | 30 | 100 |
| AY460204.1 | Hepatitis C virus from Shanghai, complete genome | 48 | .................... | 67 | 100 |
| AY651061.1 | Hepatitis C virus isolate Khaja1, complete genome | 48 | .................... | 67 | 100 |
| AY746460.1 | Hepatitis C virus genotype 2a polyprotein gene, complete cds | 47 | .................... | 66 | 100 |
| AB154177.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154178.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154179.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154180.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154181.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154182.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154183.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154185.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154186.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154187.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154189.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154191.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154192.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154194.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154198.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154199.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154200.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154201.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154202.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154203.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154204.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154205.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AB154206.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | .................... | 55 | 100 |
| AY859526.1 | Hepatitis C virus (isolate 6a33), complete genome | 2 | .................... | 21 | 100 |
| D84263.2 | Hepatitis C virus (isolate VN235) genomic RNA, complete genome | 45 | .................... | 64 | 100 |
| D84264.2 | Hepatitis C virus (isolate VN405) genomic RNA, complete genome | 45 | .................... | 64 | 100 |
| D84265.2 | Hepatitis C virus (isolate VN004) genomic RNA, complete genome | 45 | .................... | 64 | 100 |
| AB191333.1 | Hepatitis C virus genomic RNA, complete genome, strain:0 | 48 | .................... | 67 | 100 |
| AY878650.1 | Hepatitis C virus subtype 6k isolate KM45, complete genome | 31 | .................... | 50 | 100 |
| AY878651.1 | Hepatitis C virus subtype 6k isolate KM41, complete genome | 16 | .................... | 35 | 100 |
| DQ071885.1 | Hepatitis C virus subtype 1b polyprotein mRNA, complete cds | 48 | .................... | 67 | 100 |
| DQ155561.1 | Hepatitis C virus (isolate D54) polyprotein gene, partial cds | 20 | .................... | 39 | 100 |
| DQ278891.1 | Hepatitis C virus subtype 6k isolate KM45, complete genome | 47 | .................... | 66 | 100 |
| DQ278893.1 | Hepatitis C virus subtype 6k isolate KM41, complete genome | 48 | .................... | 67 | 100 |
| DQ314805.1 | Hepatitis C virus subtype 6e isolate GX004, complete genome | 45 | .................... | 64 | 100 |
| DQ314805.1 | Hepatitis C virus subtype 6e isolate GX004, complete genome | 2822 | __..cc.t............ | 2839 | 75 |
| AJ851228.1 | Hepatitis C virus gene for polyprotein, genomic RNA, isolate Equatori | 20 | .................... | 39 | 100 |
| DQ278892.1 | Hepatitis C virus isolate GZ52557, complete genome | 45 | .................... | 64 | 100 |
| DQ480512.1 | Hepatitis C virus subtype 6a strain 6a77, complete genome | 2 | .................... | 21 | 100 |
| DQ480513.1 | Hepatitis C virus subtype 6a strain 6a35, complete genome | 2 | .................... | 21 | 100 |
| DQ480514.1 | Hepatitis C virus subtype 6a strain 6a63, complete genome | 2 | .................... | 21 | 100 |
| DQ480515.1 | Hepatitis C virus subtype 6a strain 6a64, complete genome | 2 | .................... | 21 | 100 |
| DQ480516.1 | Hepatitis C virus subtype 6a strain 6a61, complete genome | 2 | .................... | 21 | 100 |
| DQ480517.1 | Hepatitis C virus subtype 6a strain 6a73, complete genome | 2 | .................... | 21 | 100 |
| DQ480518.1 | Hepatitis C virus subtype 6a strain 6a65, complete genome | 2 | .................... | 21 | 100 |
| DQ480519.1 | Hepatitis C virus subtype 6a strain 6a66, complete genome | 2 | .................... | 21 | 100 |
| DQ480520.1 | Hepatitis C virus subtype 6a strain 6a67, complete genome | 2 | .................... | 21 | 100 |
| DQ480521.1 | Hepatitis C virus subtype 6a strain 6a69, complete genome | 2 | .................... | 21 | 100 |
| DQ480522.1 | Hepatitis C virus subtype 6a strain 6a72, complete genome | 2 | .................... | 21 | 100 |
| DQ480523.1 | Hepatitis C virus subtype 6a strain 6a62, complete genome | 2 | .................... | 21 | 100 |
| DQ480524.1 | Hepatitis C virus subtype 6a strain 6a74, complete genome | 2 | .................... | 21 | 100 |
| DQ835760.1 | Hepatitis C virus subtype 6f isolate C-0044, complete genome | 45 | .................... | 64 | 100 |
| DQ835761.1 | Hepatitis C virus subtype 6j isolate C-0667, complete genome | 45 | .................... | 64 | 100 |
| DQ835762.1 | Hepatitis C virus subtype 6i isolate C-0159, complete genome | 45 | .................... | 64 | 100 |
| DQ835763.1 | Hepatitis C virus subtype 6m isolate C-0208, complete genome | 45 | .................... | 64 | 100 |
| DQ835764.1 | Hepatitis C virus subtype 6f isolate C-0046, complete genome | 45 | .................... | 64 | 100 |
| DQ835769.1 | Hepatitis C virus subtype 6j isolate Th553, complete genome | 45 | .................... | 64 | 100 |
| DQ835770.1 | Hepatitis C virus subtype 6i isolate Th602, complete genome | 45 | .................... | 64 | 100 |
| EF026073.1 | Hepatitis C virus strain RF3 2/5 polyprotein mRNA, partial cds | 25 | .................... | 44 | 100 |
| EF032892.1 | Hepatitis C virus subtype 1b isolate BR1427_P1_10.7.03 polyprotein ge | 24 | .................... | 43 | 100 |
| EF032893.1 | Hepatitis C virus subtype 1b isolate BR1427_P3_11.10.03 polyprotein g | 22 | .................... | 41 | 100 |
| AB249644.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 48 | .................... | 67 | 100 |
| AM408911.1 | Hepatitis C virus partial gene for polyprotein, recombinant 2/5, geno | 25 | .................... | 44 | 100 |
| EF424626.1 | Hepatitis C virus subtype 6p isolate QC216, complete genome | 45 | .................... | 64 | 100 |
| EF424627.1 | Hepatitis C virus subtype 6o isolate QC227, complete genome | 45 | .................... | 64 | 100 |
| EF424628.1 | Hepatitis C virus subtype 6l isolate 537796, complete genome | 45 | .................... | 64 | 100 |
| EF424629.1 | Hepatitis C virus subtype 6c isolate Th846, complete genome | 45 | .................... | 64 | 100 |
| EF621489.1 | Hepatitis C virus subtype 1a strain HC-TN, complete genome | 48 | .................... | 67 | 100 |
| EF638081.1 | Hepatitis C virus subtype 1b from Hubei, complete genome | 4 | .................... | 23 | 100 |
| EF407417.1 | Hepatitis C virus isolate 4040 polyprotein gene, complete cds | 7 | .................... | 26 | 100 |
| EF407437.1 | Hepatitis C virus isolate 1030 polyprotein gene, complete cds | 8 | .................... | 27 | 100 |
| EF407441.1 | Hepatitis C virus isolate 1036 polyprotein gene, complete cds | 7 | .................... | 26 | 100 |
| EF407443.1 | Hepatitis C virus isolate 7024 polyprotein gene, complete cds | 8 | .................... | 27 | 100 |
| EF407447.1 | Hepatitis C virus isolate 8004 polyprotein gene, complete cds | 8 | .................... | 27 | 100 |
| EF407448.1 | Hepatitis C virus isolate 6018 polyprotein gene, partial cds | 8 | .................... | 27 | 100 |
| EF407456.1 | Hepatitis C virus isolate 4025 polyprotein gene, complete cds | 7 | .................... | 26 | 100 |
| EF407461.1 | Hepatitis C virus isolate 5004 polyprotein gene, complete cds | 28 | .................... | 47 | 100 |
| EF407483.1 | Hepatitis C virus isolate 4043 polyprotein gene, complete cds | 23 | .................... | 42 | 100 |
| EF407485.1 | Hepatitis C virus isolate 7026 polyprotein gene, complete cds | 3 | .................... | 22 | 100 |
| EF407501.1 | Hepatitis C virus isolate 7055 polyprotein gene, complete cds | 21 | .................... | 40 | 100 |
| EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 9 | .................... | 28 | 100 |
| EF407502.1 | Hepatitis C virus isolate 2038 polyprotein gene, complete cds | 77 | .................... | 96 | 100 |
| EF632069.1 | Hepatitis C virus isolate TV241, complete genome | 45 | .................... | 64 | 100 |
| EF632070.1 | Hepatitis C virus isolate TV249, complete genome | 45 | .................... | 64 | 100 |
| EF632071.1 | Hepatitis C virus isolate VT21, complete genome | 31 | .................... | 50 | 100 |
| EU246930.1 | Hepatitis C virus strain D9 polyprotein gene, complete cds | 20 | .................... | 39 | 100 |
| EU246933.1 | Hepatitis C virus strain D33 polyprotein gene, complete cds | 20 | .................... | 39 | 100 |
| EU362876.1 | Hepatitis C virus isolate 1013_FU24 polyprotein (pol) gene, complete | 7 | .................... | 26 | 100 |
| EU362879.1 | Hepatitis C virus isolate 2005_FU24 polyprotein (pol) gene, partial c | 7 | .................... | 26 | 100 |
| EU362883.1 | Hepatitis C virus isolate 4025_FU24 polyprotein (pol) gene, partial c | 7 | .................... | 26 | 100 |
| EU362884.1 | Hepatitis C virus isolate 4035_FU24 polyprotein (pol) gene, complete | 10 | .................... | 29 | 100 |
| EU362890.1 | Hepatitis C virus isolate 7002_FU24 polyprotein (pol) gene, partial c | 7 | .................... | 26 | 100 |
| EU362896.1 | Hepatitis C virus isolate 7046_FU24 polyprotein (pol) gene, complete | 7 | .................... | 26 | 100 |
| EU362897.1 | Hepatitis C virus isolate 7065_FU24 polyprotein (pol) gene, complete | 7 | .................... | 26 | 100 |
| EU362900.1 | Hepatitis C virus isolate 1030q polyprotein (pol) gene, partial cds | 8 | .................... | 27 | 100 |
| EU362903.1 | Hepatitis C virus isolate 4025q polyprotein (pol) gene, partial cds | 7 | .................... | 26 | 100 |
| EU363761.1 | Recombinant Hepatitis C virus H77C/JFH1, complete genome | 47 | .................... | 66 | 100 |
| EU155330.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V130/1994, complet | 18 | .................... | 37 | 100 |
| EU155374.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V308/2005, complet | 17 | .................... | 36 | 100 |
| AB426117.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 48 | .................... | 67 | 100 |
| EU408326.1 | Hepatitis C virus isolate 537798 polyprotein precursor, gene, complet | 45 | .................... | 64 | 100 |
| EU408326.1 | Hepatitis C virus isolate 537798 polyprotein precursor, gene, complet | 2826 | ______.t............ | 2839 | 65 |
| EU408327.1 | Hepatitis C virus isolate 535318 polyprotein precursor, gene, complet | 45 | .................... | 64 | 100 |
| AB435162.2 | Hepatitis C virus subtype 1b genomic RNA, complete genome, hiroshima | 48 | .................... | 67 | 100 |
| AB429050.1 | Hepatitis C virus gene for polyprotein, complete cds, isolate: AH1 | 48 | .................... | 67 | 100 |
| AM910652.2 | Hepatitis C virus subtype 1g complete genome | 20 | .................... | 39 | 100 |
| EU158186.1 | Hepatitis C virus isolate NK46, complete genome | 14 | .................... | 33 | 100 |
| EU857431.1 | Hepatitis C virus subtype 1b isolate Whu, complete genome | 48 | .................... | 67 | 100 |
| EU798760.1 | Hepatitis C virus subtype 6v isolate KMN-02 polyprotein precursor, ge | 45 | .................... | 64 | 100 |
| EU798761.1 | Hepatitis C virus subtype 6v isolate KM046 polyprotein precursor, gen | 14 | .................... | 33 | 100 |
| AB442219.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 48 | .................... | 67 | 100 |
| AB442220.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 48 | .................... | 67 | 100 |
| AB442221.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: KAH | 48 | .................... | 67 | 100 |
| AB442222.1 | Hepatitis C virus subtype 1b genomic RNA, complete genome, clone: 1B- | 48 | .................... | 67 | 100 |
| FJ435090.1 | Hepatitis C virus isolate KM181 genotype 6v, complete genome | 45 | .................... | 64 | 100 |
| FJ462431.1 | Hepatitis C virus isolate QC139, complete genome | 47 | .................... | 66 | 100 |
| FJ462432.1 | Hepatitis C virus isolate QC193, complete genome | 47 | .................... | 66 | 100 |
| FJ462433.1 | Hepatitis C virus isolate QC249, complete genome | 47 | .................... | 66 | 100 |
| FJ462434.1 | Hepatitis C virus isolate QC262, complete genome | 47 | .................... | 66 | 100 |
| FJ462435.1 | Hepatitis C virus isolate QC264, complete genome | 47 | .................... | 66 | 100 |
| FJ462436.1 | Hepatitis C virus isolate QC381, complete genome | 47 | .................... | 66 | 100 |
| FJ462437.1 | Hepatitis C virus isolate QC382, complete genome | 47 | .................... | 66 | 100 |
| FJ462438.1 | Hepatitis C virus isolate QC383, complete genome | 47 | .................... | 66 | 100 |
| FJ462439.1 | Hepatitis C virus isolate QC384, complete genome | 47 | .................... | 66 | 100 |
| FJ462440.1 | Hepatitis C virus isolate QC93, complete genome | 47 | .................... | 66 | 100 |
| FJ462441.1 | Hepatitis C virus isolate QC97, complete genome | 47 | .................... | 66 | 100 |
| FJ839869.1 | Hepatitis C virus isolate QC155, complete genome | 47 | .................... | 66 | 100 |
| FJ839870.1 | Hepatitis C virus isolate QC274, complete genome | 47 | .................... | 66 | 100 |
| FN435993.1 | Hepatitis C virus subtype 1b complete genome, isolate EU1, genomic RN | 48 | .................... | 67 | 100 |
| AB520610.1 | Hepatitis C virus subtype 1a genomic RNA, complete genome, strain: HC | 48 | .................... | 67 | 100 |
| FJ821465.1 | Hepatitis C virus strain M21-2k/1b, complete genome | 21 | .................... | 40 | 100 |
| AB559564.1 | Hepatitis C virus HCV gene for hepatitis C virus polyprotein, complet | 48 | .................... | 67 | 100 |
| GU133617.1 | Hepatitis C virus subtype 1b, complete genome | 48 | .................... | 67 | 100 |
| FN666428.2 | Hepatitis C virus gene for polyprotein, genomic RNA, subtype 2q, isol | 20 | .................... | 39 | 100 |
| D84262.2 | Hepatitis C virus (isolate Th580) genomic RNA, complete genome GCCAGC | 46 | .................... | 65 | 100 |
| AF177036.1 | Hepatitis C virus subtype 2a strain HC-J6CH clone pJ6CF, complete gen | 47 | .................... | 66 | 100 |
| AF009606.1 | Hepatitis C virus subtype 1a polyprotein gene, complete cds | 48 | .................... | 67 | 100 |
| AB047645.1 | Hepatitis C virus gene for polyprotein, complete cds, clone:JCH-6 | 48 | _................... | 66 | 95 |
| EF407470.1 | Hepatitis C virus isolate 4064 polyprotein gene, complete cds | 1 | _................... | 19 | 95 |
| U01214.1 | HCU01214 Hepatitis C virus subtype 1b strain HCV-L2, complete genome | 49 | ..........t......... | 68 | 95 |
| D28917.1 | HPCK3A Hepatitis C virus (isolate HCV-K3a/650) genomic RNA, complete g | 46 | .........t.......... | 65 | 95 |
| D49374.1 | HPCFG Hepatitis C virus (isolate Tr Kj) genomic RNA, complete genome | 46 | .........t.......... | 65 | 95 |
| D63821.1 | HPCJK049E1 Hepatitis C virus (isolate JK049) genomic RNA, complete gen | 46 | .........t.......... | 65 | 95 |
| AF011753.1 | Hepatitis C virus strain H77 pH21 polyprotein gene, complete cds | 48 | ..........t......... | 67 | 95 |
| AF046866.1 | Hepatitis C virus subtype 3a strain CB polyprotein gene, complete cds | 46 | .........t.......... | 65 | 95 |
| AF207754.1 | Hepatitis C virus subtype 1b strain MD13, complete genome | 36 | ..........t......... | 55 | 95 |
| AF207759.1 | Hepatitis C virus subtype 1b strain MD18, complete genome | 36 | .................a.. | 55 | 95 |
| AF207772.1 | Hepatitis C virus subtype 1b strain MD31, complete genome | 36 | ..........t......... | 55 | 95 |
| AB154190.1 | Hepatitis C virus subtype 1b gene for polyprotein, partial cds, isola | 36 | ....t............... | 55 | 95 |
| AY878652.1 | Hepatitis C virus subtype 6n isolate KM42, complete genome | 15 | ..........a......... | 34 | 95 |
| DQ278894.1 | Hepatitis C virus subtype 6n isolate KM42, complete genome | 49 | ..........a......... | 68 | 95 |
| DQ314806.1 | Hepatitis C virus subtype 6g isolate HK6554, complete genome | 45 | ......g............. | 64 | 95 |
| DQ835765.1 | Hepatitis C virus subtype 6m isolate C-0185, complete genome | 45 | ..........a......... | 64 | 95 |
| DQ835766.1 | Hepatitis C virus subtype 6m isolate C-0192, complete genome | 45 | ..........a......... | 64 | 95 |
| DQ835767.1 | Hepatitis C virus subtype 6m isolate B4/92, complete genome | 45 | ..........a......... | 64 | 95 |
| DQ835768.1 | Hepatitis C virus subtype 6n isolate D86/93, complete genome | 45 | ..........a......... | 64 | 95 |
| EF424625.1 | Hepatitis C virus subtype 6q isolate QC99, complete genome | 45 | ..........t......... | 64 | 95 |
| EF407493.1 | Hepatitis C virus isolate 3031 polyprotein gene, complete cds | 3 | .......t............ | 22 | 95 |
| EU246939.1 | Hepatitis C virus strain D49 polyprotein gene, complete cds | 20 | ....a............... | 39 | 95 |
| FJ407092.1 | Hepatitis C virus isolate IND-HCV-3i, complete genome | 46 | .........t.......... | 65 | 95 |
| GQ275355.1 | Hepatitis C virus subtype 3a, complete genome | 46 | .........t.......... | 65 | 95 |
| D17763.1 | HPCEGS Hepatitis C virus (isolate NZL1) genomic RNA, complete genome | 46 | .........t.......... | 65 | 95 |
| EF407419.1 | Hepatitis C virus isolate 5003 polyprotein gene, complete cds | 1 | __.................. | 18 | 90 |
| EF407433.1 | Hepatitis C virus isolate 7046 polyprotein gene, complete cds | 1 | __.................. | 18 | 90 |
| EF407455.1 | Hepatitis C virus isolate 7065 polyprotein gene, complete cds | 10 | __.................. | 27 | 90 |
| EF407415.1 | Hepatitis C virus isolate 3018 polyprotein gene, complete cds | 1 | ___................. | 17 | 85 |
| EF407432.1 | Hepatitis C virus isolate 1013 polyprotein gene, complete cds | 12 | ___................. | 28 | 85 |
| EF407449.1 | Hepatitis C virus isolate 2027 polyprotein gene, complete cds | 11 | ___................. | 27 | 85 |
| EF407460.1 | Hepatitis C virus isolate 8007 polyprotein gene, complete cds | 1 | ___................. | 17 | 85 |
| EU362899.1 | Hepatitis C virus isolate 1013q polyprotein (pol) gene, partial cds | 12 | ___................. | 28 | 85 |
| EU362902.1 | Hepatitis C virus isolate 2027q polyprotein (pol) gene, partial cds | 11 | ___................. | 27 | 85 |
| EF407504.1 | Hepatitis C virus isolate 8069 polyprotein gene, complete cds | 2 | ..ga................ | 21 | 90 |
| EF407426.1 | Hepatitis C virus isolate 8070 polyprotein genomic sequence | 1 | ____................ | 16 | 80 |
| AF165047.1 | Hepatitis C virus subtype 1b strain MD2-1, complete genome | 37 | _......t.........a.. | 55 | 85 |
| AF165048.1 | Hepatitis C virus subtype 1b strain MD2-2, complete genome | 37 | _......t.........a.. | 55 | 85 |
| EU362878.1 | Hepatitis C virus isolate 1030_FU24 polyprotein (pol) gene, partial c | 11 | ___.a............... | 27 | 80 |
| AY587844.1 | Hepatitis C virus strain N589 polyprotein gene, complete cds | 1 | _____............... | 15 | 75 |
| EF407440.1 | Hepatitis C virus isolate 7002 polyprotein gene, complete cds | 1 | _____............... | 15 | 75 |
| EU362907.1 | Hepatitis C virus isolate 7002q polyprotein (pol) gene, complete cds | 1 | _____............... | 15 | 75 |
| EU239713.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V316/2001, complet | 1 | _____............... | 15 | 75 |
| EU239714.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V417/2001, complet | 1 | _____............... | 15 | 75 |
| EU234061.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V126/1991, complet | 1 | _____............... | 15 | 75 |
| EU234062.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V135/1992, complet | 1 | _____............... | 15 | 75 |
| EU155217.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V142/2004, complet | 1 | _____............... | 15 | 75 |
| EU155218.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V145/2005, complet | 1 | _____............... | 15 | 75 |
| EU155219.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V146/2002, complet | 1 | _____............... | 15 | 75 |
| EU155221.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V148/2004, complet | 1 | _____............... | 15 | 75 |
| EU155222.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V150/2004, complet | 1 | _____............... | 15 | 75 |
| EU155223.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V151/2002, complet | 1 | _____............... | 15 | 75 |
| EU155224.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V152/2003, complet | 1 | _____............... | 15 | 75 |
| EU155225.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V155/2003, complet | 1 | _____............... | 15 | 75 |
| EU155226.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V156/2004, complet | 1 | _____............... | 15 | 75 |
| EU155227.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V157/2003, complet | 1 | _____............... | 15 | 75 |
| EU155228.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V158/2003, complet | 1 | _____............... | 15 | 75 |
| EU155229.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V159/2004, complet | 1 | _____............... | 15 | 75 |
| EU155230.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V160/2002, complet | 1 | _____............... | 15 | 75 |
| EU155231.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V163/2002, complet | 1 | _____............... | 15 | 75 |
| EU155232.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V164/2002, complet | 1 | _____............... | 15 | 75 |
| EU155234.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V447/2006, complet | 1 | _____............... | 15 | 75 |
| EU155235.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V449/2006, complet | 1 | _____............... | 15 | 75 |
| EU482833.1 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V503/2003, complet | 1 | _____............... | 15 | 75 |
| EU482839.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V370/2006, complet | 1 | _____............... | 15 | 75 |
| EU482849.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V138/1989, complet | 1 | _____............... | 15 | 75 |
| EU482859.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V272/2003, complet | 1 | _____............... | 15 | 75 |
| EU482860.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V302/2003, complet | 1 | _____............... | 15 | 75 |
| EU482874.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V287/2005, complet | 1 | _____............... | 15 | 75 |
| EU482875.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V310/2005, complet | 1 | _____............... | 15 | 75 |
| EU482877.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V342/2001, complet | 1 | _____............... | 15 | 75 |
| EU482879.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V372/2006, complet | 1 | _____............... | 15 | 75 |
| EU482880.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V373/2006, complet | 1 | _____............... | 15 | 75 |
| EU482881.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V383/2003, complet | 1 | _____............... | 15 | 75 |
| EU482883.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V153/2005, complet | 1 | _____............... | 15 | 75 |
| EU482885.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V448/2006, complet | 1 | _____............... | 15 | 75 |
| EU482886.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V458/2006, complet | 1 | _____............... | 15 | 75 |
| EU482888.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V123/1992, complet | 1 | _____............... | 15 | 75 |
| EU155253.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V363/2006, complet | 1 | _____............... | 15 | 75 |
| EU155254.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V365/2006, complet | 1 | _____............... | 15 | 75 |
| EU155255.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V366/2006, complet | 1 | _____............... | 15 | 75 |
| EU155256.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V367/2006, complet | 1 | _____............... | 15 | 75 |
| EU155257.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V369/2006, complet | 1 | _____............... | 15 | 75 |
| EU155258.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V371/2006, complet | 1 | _____............... | 15 | 75 |
| EU155259.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V374/2006, complet | 1 | _____............... | 15 | 75 |
| EU155260.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V375/2006, complet | 1 | _____............... | 15 | 75 |
| EU155262.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V381/2001, complet | 1 | _____............... | 15 | 75 |
| EU155263.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V384/2005, complet | 1 | _____............... | 15 | 75 |
| EU155279.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V441/2001, complet | 1 | _____............... | 15 | 75 |
| EU155280.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V442/2001, complet | 1 | _____............... | 15 | 75 |
| EU155281.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V512/2005, complet | 1 | _____............... | 15 | 75 |
| EU155287.2 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V320/2001, complet | 1 | _____............... | 15 | 75 |
| EU155301.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V344/2001, complet | 1 | _____............... | 15 | 75 |
| EU155302.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V345/2001, complet | 1 | _____............... | 15 | 75 |
| EU155303.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V346/2001, complet | 1 | _____............... | 15 | 75 |
| EU155305.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V350/2002, complet | 1 | _____............... | 15 | 75 |
| EU155306.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V352/2002, complet | 1 | _____............... | 15 | 75 |
| EU155307.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V353/2002, complet | 1 | _____............... | 15 | 75 |
| EU155308.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V354/2003, complet | 1 | _____............... | 15 | 75 |
| EU155315.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V416/2001, complet | 1 | _____............... | 15 | 75 |
| EU155316.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V419/2002, complet | 1 | _____............... | 15 | 75 |
| EU155317.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V420/2002, complet | 1 | _____............... | 15 | 75 |
| EU155318.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V421/2005, complet | 1 | _____............... | 15 | 75 |
| EU155324.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V121/1992, complet | 1 | _____............... | 15 | 75 |
| EU155325.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V122/1991, complet | 1 | _____............... | 15 | 75 |
| EU155326.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V124/1992, complet | 1 | _____............... | 15 | 75 |
| EU155328.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V127/1992, complet | 1 | _____............... | 15 | 75 |
| EU155329.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V128/1992, complet | 1 | _____............... | 15 | 75 |
| EU155331.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V131/1990, complet | 1 | _____............... | 15 | 75 |
| EU155332.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V132/1996, complet | 1 | _____............... | 15 | 75 |
| EU155334.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V134/1990, complet | 1 | _____............... | 15 | 75 |
| EU155335.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V136/1992, complet | 1 | _____............... | 15 | 75 |
| EU155336.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V139/1992, complet | 1 | _____............... | 15 | 75 |
| EU155337.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V141/1990, complet | 1 | _____............... | 15 | 75 |
| EU155356.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V273/2003, complet | 1 | _____............... | 15 | 75 |
| EU155357.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V275/2003, complet | 1 | _____............... | 15 | 75 |
| EU155358.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V276/2004, complet | 1 | _____............... | 15 | 75 |
| EU155359.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V277/2002, complet | 1 | _____............... | 15 | 75 |
| EU155360.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V278/2003, complet | 1 | _____............... | 15 | 75 |
| EU155361.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V281/2004, complet | 1 | _____............... | 15 | 75 |
| EU155362.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V282/2004, complet | 1 | _____............... | 15 | 75 |
| EU155363.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V285/2005, complet | 1 | _____............... | 15 | 75 |
| EU155364.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V288/2006, complet | 1 | _____............... | 15 | 75 |
| EU155365.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V289/2006, complet | 1 | _____............... | 15 | 75 |
| EU155366.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V294/2002, complet | 1 | _____............... | 15 | 75 |
| EU155367.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V295/2002, complet | 1 | _____............... | 15 | 75 |
| EU155368.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V296/2001, complet | 1 | _____............... | 15 | 75 |
| EU155369.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V297/2002, complet | 1 | _____............... | 15 | 75 |
| EU155370.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V300/2005, complet | 1 | _____............... | 15 | 75 |
| EU155371.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V301/2005, complet | 1 | _____............... | 15 | 75 |
| EU155372.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V306/2004, complet | 1 | _____............... | 15 | 75 |
| EU155373.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V307/2005, complet | 1 | _____............... | 15 | 75 |
| EU155375.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V309/2006, complet | 1 | _____............... | 15 | 75 |
| EU155376.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V311/2006, complet | 1 | _____............... | 15 | 75 |
| EU155377.2 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V313/2006, complet | 1 | _____............... | 15 | 75 |
| EU155381.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V502/2004, complet | 1 | _____............... | 15 | 75 |
| EU155382.2 | Hepatitis C virus subtype 1b isolate HCV-1b/DE/BID-V504/2003, complet | 1 | _____............... | 15 | 75 |
| EU660384.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V55/2005, complete | 1 | _____............... | 15 | 75 |
| EU660386.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V355/2006, complet | 1 | _____............... | 15 | 75 |
| EU660388.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V154/2001, complet | 1 | _____............... | 15 | 75 |
| EU255957.1 | Hepatitis C virus subtype 1a isolate HCV-1a/CH/BID-V260/2004, complet | 1 | _____............... | 15 | 75 |
| EU255960.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V312/2006, complet | 1 | _____............... | 15 | 75 |
| EU256059.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V220/2005, complet | 1 | _____............... | 15 | 75 |
| EU256061.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V364/2006, complet | 1 | _____............... | 15 | 75 |
| EU256062.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V368/2006, complet | 1 | _____............... | 15 | 75 |
| EU256064.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V376/2006, complet | 1 | _____............... | 15 | 75 |
| EU256065.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V377/2006, complet | 1 | _____............... | 15 | 75 |
| EU256066.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V382/2003, complet | 1 | _____............... | 15 | 75 |
| EU256088.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V149/2003, complet | 1 | _____............... | 15 | 75 |
| EU256089.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V161/2002, complet | 1 | _____............... | 15 | 75 |
| EU256090.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V162/2002, complet | 1 | _____............... | 15 | 75 |
| EU256092.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V463/2006, complet | 1 | _____............... | 15 | 75 |
| EU256098.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V343/2002, complet | 1 | _____............... | 15 | 75 |
| EU256099.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V348/2002, complet | 1 | _____............... | 15 | 75 |
| EU256100.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V349/2002, complet | 1 | _____............... | 15 | 75 |
| EU256101.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V351/2002, complet | 1 | _____............... | 15 | 75 |
| EU256102.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V415/2001, complet | 1 | _____............... | 15 | 75 |
| EU256103.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V418/2001, complet | 1 | _____............... | 15 | 75 |
| EU256105.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V505/2001, complet | 1 | _____............... | 15 | 75 |
| EU256000.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V143/2003, complet | 1 | _____............... | 15 | 75 |
| EU256001.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V144/2002, complet | 1 | _____............... | 15 | 75 |
| EU256045.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V380/2003, complet | 1 | _____............... | 15 | 75 |
| EU256054.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V443/2001, complet | 1 | _____............... | 15 | 75 |
| EU256075.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V279/2004, complet | 1 | _____............... | 15 | 75 |
| EU256076.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V280/2004, complet | 1 | _____............... | 15 | 75 |
| EU256077.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V283/2005, complet | 1 | _____............... | 15 | 75 |
| EU256078.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V284/2005, complet | 1 | _____............... | 15 | 75 |
| EU256079.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V286/2005, complet | 1 | _____............... | 15 | 75 |
| EU256080.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V292/2002, complet | 1 | _____............... | 15 | 75 |
| EU256081.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V293/2002, complet | 1 | _____............... | 15 | 75 |
| EU256082.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V298/2005, complet | 1 | _____............... | 15 | 75 |
| EU256083.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V299/2005, complet | 1 | _____............... | 15 | 75 |
| EU256084.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V303/2003, complet | 1 | _____............... | 15 | 75 |
| EU256085.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V305/2003, complet | 1 | _____............... | 15 | 75 |
| EU255961.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V137/1991, complet | 1 | _____............... | 15 | 75 |
| FJ024086.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1704/2007, comple | 1 | _____............... | 15 | 75 |
| FJ024277.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1711/2007, comple | 1 | _____............... | 15 | 75 |
| FJ024279.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1715/2007, comple | 1 | _____............... | 15 | 75 |
| EU862835.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V509/2001, partial | 1 | _____............... | 15 | 75 |
| FJ205867.1 | Hepatitis C virus subtype 1a isolate HCV-1a/US/BID-V1709/2007, comple | 1 | _____............... | 15 | 75 |
| FJ390396.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1748/2007, comple | 1 | _____............... | 15 | 75 |
| FJ390397.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1749/2008, comple | 1 | _____............... | 15 | 75 |
| FJ390398.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V1750/2008, comple | 1 | _____............... | 15 | 75 |
| FJ478453.1 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V2148/1999, comple | 1 | _____............... | 15 | 75 |
| EU862837.1 | Hepatitis C virus subtype 1b isolate HCV-1b/CH/BID-V304/2004, complet | 1 | _____............... | 15 | 75 |
| EF407413.1 | Hepatitis C virus isolate 5012 polyprotein gene, complete cds | 1 | ______.............. | 14 | 70 |
| EF407427.1 | Hepatitis C virus isolate 6025 polyprotein gene, complete cds | 1 | ______.............. | 14 | 70 |
| EF407438.1 | Hepatitis C virus isolate 7012 polyprotein gene, complete cds | 1 | ______.............. | 14 | 70 |
| EF407453.1 | Hepatitis C virus isolate 4035 polyprotein gene, complete cds | 1 | ______.............. | 14 | 70 |
| EU362881.1 | Hepatitis C virus isolate 2027_FU24 polyprotein (pol) gene, partial c | 14 | ______.............. | 27 | 70 |
| EU155261.2 | Hepatitis C virus subtype 1b isolate HCV-1b/US/BID-V379/2005, complet | 1 | _____....c.......... | 15 | 70 |
| EF407423.1 | Hepatitis C virus isolate 8028 polyprotein gene, complete cds | 1 | _______............. | 13 | 65 |
| EF407487.1 | Hepatitis C virus isolate 6057 polyprotein gene, complete cds | 1 | ______.t............ | 14 | 65 |
| EF407503.1 | Hepatitis C virus isolate 5083 polyprotein gene, complete cds | 1 | ______.t............ | 14 | 65 |
| EF407439.1 | Hepatitis C virus isolate 8003 polyprotein gene, complete cds | 1 | ________............ | 12 | 60 |
| EF407465.1 | Hepatitis C virus isolate 6017 polyprotein gene, complete cds | 1 | ________............ | 12 | 60 |
| EF407471.1 | Hepatitis C virus isolate 5044 polyprotein gene, complete cds | 1 | ________............ | 12 | 60 |
| EF407472.1 | Hepatitis C virus isolate 4034 polyprotein gene, complete cds | 2 | ________............ | 13 | 60 |
| EF407479.1 | Hepatitis C virus isolate 4036 polyprotein gene, complete cds | 1 | ________............ | 12 | 60 |
| EU362892.1 | Hepatitis C virus isolate 7012_FU24 polyprotein (pol) gene, complete | 1 | ________............ | 12 | 60 |